DOI > 10.5291/ILL-DATA.8-03-980

This proposal is publicly available since 09/19/2024

Title

Photoinduced structural changes in DNA G-quadruplex-porphyrin complexes

Abstract

G-quadruplex (G4) are higher-order four-stranded structures occurring in nucleic acid sequences composed of several runs of guanine nucleosides. They consist of stacks of planar G-quartets stabilized by Hoogsteen-type H-bonds. Stable G4 may inhibit telomerase extension, and are emerging as therapeutic targets for small-molecules. In this context, photosensitive ligands are a versatile platform to study how the conformation of the G4-complex can be modulated by suitable light-induced stimuli. Here we propose to use SANS to study structural modifications of G4-porphyrin complexes in both dark and illuminated states. The final goal is to define a protocol for controlling the G4 stability and conformation by a rational use of light-sensitive molecules.

Experimental Report

Download Data

Please note that you will need to login with your ILL credentials to download the data.

Download Data

Data Citation

The recommended format for citing this dataset in a research publication is in the following format:

COMEZ Lucia; COLLETIER Jacques Philippe; MARTEL Anne; Alessandro Paciaroni; SCHIRO Giorgio and WEIK Martin. (2019). Photoinduced structural changes in DNA G-quadruplex-porphyrin complexes. Institut Laue-Langevin (ILL) doi:10.5291/ILL-DATA.8-03-980

Cited by

This data has not been cited by any articles.

Metadata

Experiment Parameters

  • Environment temperature

    300 K
  • Experiment energy

    6 Ang
  • Experiment moment

    0.02-0.3 Ang-1

Sample Parameters

  • Formula

    • AGGGTTAGGGTTAGGGTTAGGG + H20
    • TMPyP4 + H20